![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 23:00
The dna in a cell’s nucleus encodes proteins that are eventually targeted to every membrane and compartment in the cell, as well as proteins that are targeted for secretion from the cell. for example, consider these two proteins: phosphofructokinase (pfk) is an enzyme that functions in the cytoplasm during glycolysis. insulin, a protein that regulates blood sugar levels, is secreted from specialized pancreatic cells. assume that you can track the cellular locations of these two proteins from the time that translation is complete until the proteins reach their final destinations.for each protein, identify its targeting pathway: the sequence of cellular locations in which the protein is found from when translation is complete until it reaches its final (functional) destination. (note that if an organelle is listed in a pathway, the location implied is inside the organelle, not in the membrane that surrounds the organelle.)
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:30
In a hypothetical breed of dogs, coat color is controlled by two genes. there are six different coat colors in this breed: black, brown, cream, gray, silver, and tan. consider the following crosses. cross 1: black females from a lineage of all black dogs are crossed with brown males from a lineage of all brown dogs. f1 males and females are all black. when f1 are intercrossed, f2 males and females are black or brown. cross 2: black females from a lineage of all black dogs are crossed with tan males from a lineage where all males are tan and all females are cream. f1 males are black, f1 females are gray. when f1 are intercrossed, f2 males and females are black, brown, gray, or tan. cross 3: silver females from a lineage where all females are silver and all males are gray are crossed with brown males from a lineage of all brown dogs. f1 males and females are all gray. when f1 are intercrossed, f2 males are black, brown, gray, or tan, f2 females are cream, gray, silver, or tan. select the correct statements regarding the mode of inheritance of the coat color genes. a) both genes are x-linked. b) both genes are autosomal. c) one of the genes modifies the expression of the other gene. d) each gene has an additive effect on the intensity of coat color. e) each gene independently specifies three colors. f) one of the genes is autosomal, and the other is x-linked.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 14:30
How can we use spectral lines of light coming from the superclusters to identify which is receding from earth at the slowest rate.
Answers: 2
You know the right answer?
The gallbladder lies in the:...
Questions
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
History, 17.03.2021 23:50
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 17.03.2021 23:50
![question](/tpl/images/cats/mat.png)
Mathematics, 17.03.2021 23:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 17.03.2021 23:50
![question](/tpl/images/cats/mat.png)
Mathematics, 17.03.2021 23:50
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/en.png)
English, 17.03.2021 23:50
![question](/tpl/images/cats/fizika.png)
Physics, 17.03.2021 23:50
![question](/tpl/images/cats/istoriya.png)
History, 17.03.2021 23:50