![subject](/tpl/images/cats/biologiya.png)
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?
a. Normal gene: ATGGCCGGCCCGAAAGAGACC
b. Mutated gene: ATGGCCGGCACCGAAAGAGACC
c. Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr
d. Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:00
When lactate builds up in a runners muscles it causes a burning sensation what causes this to occur
Answers: 1
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:30
In "the pig," what is the main effect that the piglet initially has on kibuka?
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:40
Which of the following best describes the expensive tissue hypothesis? brains require more energy, so the gut had to be reduced, and larger brains and tool use led to higher quality diets. increasing body size means that homo neanderthalensis had to include more fat in its diet. brains require more energy, so the gut had to be reduced as brains got bigger. brains require more fat, so the gastrointestinal viscera (gut) had to expand, and hands were needed to acquire more food.
Answers: 1
You know the right answer?
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 14:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 14:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 14:01
![question](/tpl/images/cats/health.png)
Health, 11.09.2020 14:01
![question](/tpl/images/cats/geografiya.png)
Geography, 11.09.2020 14:01
![question](/tpl/images/cats/himiya.png)
Chemistry, 11.09.2020 14:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 14:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 14:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 14:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 14:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 14:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 14:01
![question](/tpl/images/cats/biologiya.png)
Biology, 11.09.2020 14:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 14:01
![question](/tpl/images/cats/en.png)
English, 11.09.2020 14:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 14:01
![question](/tpl/images/cats/fizika.png)
Physics, 11.09.2020 14:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 14:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 14:01
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 11.09.2020 14:01