subject
Biology, 31.03.2020 01:51 demetricejames

In pea plants, the allele for round peas (R) is dominant to the allele for wrinkled peas (r). A gardener has a plant he got from his neighbor that produces round peas, but he does not know its genotype. What simple procedure could he do to determine the genotype of his new plant

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 15:30
Which one is an advantage of external fertilization a. the offspring are genetically identical to the parents b. more eggs can be fertilzed at one time c. more sperm can be released at one time d. more protection is available for developing plz
Answers: 1
question
Biology, 22.06.2019 18:10
1. an enzyme is considered a(n) because it speeds up a chemical reaction without being used up.2. in a catalyzed reaction, a reactant is often called a(n) . an enzyme is specific because the shape of its matches only particular reactants.4. an enzyme speeds up reactions by lowering the . the between an active site and its substrate often strains bonds and the reaction proceed.6. a( , which is often a vitamin, binds to an enzyme and plays a role in catalysis.7. high temperatures or changes in ph can an enzyme, causing it to lose its shape and biological activity.
Answers: 2
question
Biology, 22.06.2019 18:30
Someone with these questions! pls 30 pts
Answers: 1
You know the right answer?
In pea plants, the allele for round peas (R) is dominant to the allele for wrinkled peas (r). A gard...
Questions