subject
Biology, 10.03.2020 20:24 zhellyyyyy

Some monkey flowers (Mimulus guttatus) living near the sites of copper mines can grow in soil containing high concentrations of copper, which is toxic to most plants. Copper tolerance is a heritable trait. The map below shows the area near an old copper mine, which contaminated the nearby soil with copper. A stream flows past the mine toward the lake at the bottom right of the map. Use the map to determine which of the statements below are true. Select the three statements that are true. A) The population that existed before mining must have included both copper-tolerant and copper-intolerant plants.
B) Nearly 100% of monkey flowers growing in copper-contaminated soil are copper tolerant.
C) Natural selection favors copper tolerance inallsoils near the old mine, not only in the contaminated soils.
D) Copper contamination in the soil created copper-tolerant plants.
E) Copper-tolerant plants are foundonlyin contaminated soils.
F) If you were to test monkey flowers growing on the shore of the lake, you would expect nearly 100% of them to be copper tolerant.

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 07:50
Pentane with molecular formula c5h12, exists in three isomeric forms. one shows linear carbon chains, another has one -ch3 groups present on the third carbon atom, and the third has two -ch3 groups present on the second carbon atom. what types of isomers are these? a. geometric isomers b. structural isomers c. halotropic isomers
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:30
How do all types of diffusion/passive transport actually ‘work’ without using even the smallest amount of cellular energy?
Answers: 1
question
Biology, 22.06.2019 13:00
What is gene expression control that occurs after the generation of rna
Answers: 3
You know the right answer?
Some monkey flowers (Mimulus guttatus) living near the sites of copper mines can grow in soil contai...
Questions
question
Chemistry, 29.08.2021 08:20
question
Mathematics, 29.08.2021 08:20
question
Chemistry, 29.08.2021 08:20
question
Computers and Technology, 29.08.2021 08:20