![subject](/tpl/images/cats/biologiya.png)
Biology, 10.03.2020 03:32 borgesalfonso12
Sexually reproducing organisms use a variety of strategies to compensate for the gene dosage differences arising from different numbers of X-chromosomes present in males and females. Please describe how dosage compensation of X-chromosome is achieved in mice and Drosophila (fruit flies)?
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 17:30
In order to clone adult animals, scientists typically begin with a(n)
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:20
All organisms contribute some water to the water cycle by conducting
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 14:20
As scientist had investigated evolution from a variety fields they have found
Answers: 2
You know the right answer?
Sexually reproducing organisms use a variety of strategies to compensate for the gene dosage differe...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 13.06.2020 23:57
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 13.06.2020 23:57
![question](/tpl/images/cats/mat.png)
Mathematics, 13.06.2020 23:57
![question](/tpl/images/cats/istoriya.png)
History, 13.06.2020 23:57
![question](/tpl/images/cats/biologiya.png)
Biology, 13.06.2020 23:57
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/ekonomika.png)
Business, 13.06.2020 23:57
![question](/tpl/images/cats/mat.png)
Mathematics, 13.06.2020 23:57
![question](/tpl/images/cats/mat.png)
Mathematics, 13.06.2020 23:57
![question](/tpl/images/cats/mat.png)
Mathematics, 13.06.2020 23:57
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 13.06.2020 23:57
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)