Biology, 07.03.2020 04:03 stefanylopez731
DNA replication
1. uses each strand of a DNA molecule as a template for the creation of a new strand.
2. begins when two DNA molecules join together to exchange segments.
3. results in the formation of four new DNA strands.
4. occurs through the addition of nucleotides to the end of the parental DNA molecule.
Answers: 1
Biology, 21.06.2019 16:00
Dwarf galaxies are select one: a. relatively rare. b. not very bright c. mostly spiral shaped. d. none of these.
Answers: 1
Biology, 21.06.2019 17:30
What claim did thorne make? what evidence supported his claim?
Answers: 3
Biology, 22.06.2019 09:00
What is responsible for the uneven heating between the poles and the equator on any given day
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
DNA replication
1. uses each strand of a DNA molecule as a template for the creation of a new...
1. uses each strand of a DNA molecule as a template for the creation of a new...
Physics, 05.02.2022 15:40
Chemistry, 05.02.2022 15:40
Chemistry, 05.02.2022 15:40
Mathematics, 05.02.2022 15:40
History, 05.02.2022 15:40
Mathematics, 05.02.2022 15:40
Mathematics, 05.02.2022 15:50
Mathematics, 05.02.2022 15:50
Chemistry, 05.02.2022 15:50
Mathematics, 05.02.2022 15:50
History, 05.02.2022 15:50
Mathematics, 05.02.2022 15:50