subject
Biology, 27.02.2020 21:56 nadinealonzo6121

People with Crohn's disease may develop lactose intolerance caused by damage to their small intestine. These
people may take a commercial product called Lactaid to prevent digestive upset when consuming dairy prod-
ucts. What is in Lactaid that helps these people avoid those symptoms? Explain how this relates to what you
learned about the specificity of enzymes for substrates in this lab.

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 01:30
Aperson with age is more likely to catch diseases that healthy people usually don’t catch.what are these infections called?
Answers: 1
question
Biology, 22.06.2019 06:30
The energy required to vaporize a certain amount of a substance is greater than the amount of energy necessary to raise the temperature of the same amout of that substance by 1 degreee celcius
Answers: 2
question
Biology, 22.06.2019 11:30
According to theories of how life began, how did early organic molecules begin to separate from the outside world? a: specialized enzymes were required b: chains of amino acids created a barrier c: formation of microspheres or vesicles d: rna catalyzed the formation of membranes
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
People with Crohn's disease may develop lactose intolerance caused by damage to their small intestin...
Questions
question
Mathematics, 08.12.2021 21:20
question
Social Studies, 08.12.2021 21:20