Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter.

ATGTCTCTCACCAACAAGAACGTC

ATGgCTCTCACCAACAAGAACGTC

ATGTCgCTCACCAACAAGAACGTC

ATGTCTtTgACCAACAAGAACGTC

a. What are the first eight amino acids for each of these four DNA sequences?

b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism.

c. Synonymous polymorphisms tend to be more common than nonsynonymous ones. Why might that be?

sand 60

clay 10

silt 30

sandy loam should be dominated by the sand. as the amount of sand increased, the amount of slit needed to anchor the plants' roots to the sand will also be increased. even though the amount is very little, 10% part of clay is still necessary for proper oxidation.

a tetrad is the foursome during meiosis made by two homologous chromosomes that have each already replicated into a pair of sister chromatids.

the answer is b.) hydrogen bonds between bases.

your body is trying to warm itself up. or more precisely, sensors in your skin send messages to your brain to generate heat to your body.