subject
Biology, 14.02.2020 07:23 tewilliams1

Meiosis is a process that occurs in sexually-reproducing organisms. This process is divided into two phases-meiosis I and meiosis
II. At the conclusion of meiosis I, there are
A
four daughter cells that each contain only one chromatid from each parental chromosome.
B. two daughter cells that each contain only one chromatid from each parental chromosome.
C. two daughter cells that each contain only one homologous chromosome from each parental pair.
D. four daughter cells that each contain only one homologous chromosome from each parental pair.

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 17:40
What links the two strands in a dna helix together in the middle? a. phosphate groups b. sugar rings bonded together c. proteins d. bases with hydrogen bonds
Answers: 1
question
Biology, 21.06.2019 22:20
Which of the following is a way that minerals are used? a. industry construction technology d. all of the above
Answers: 2
question
Biology, 22.06.2019 09:40
What molecule contains an organisms genetic material, passed down from parents to their offspring
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Meiosis is a process that occurs in sexually-reproducing organisms. This process is divided into two...
Questions
question
Mathematics, 22.09.2021 05:40
question
Biology, 22.09.2021 05:40
question
Mathematics, 22.09.2021 05:40
question
Mathematics, 22.09.2021 05:40