PLEASE HELP!
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine the DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Be sure to answer this question in paragraph form using complete sentences.

After frida stops exercising, she continues to breathe heavily. what is most likely occurring in her body? heavy breathing during exercise has produced an oxygen surplus in her muscles. this oxygen is being transported to her lungs. this is a result of aerobic respiration. heavy breathing during exercise has produced a carbon dioxide surplus in her muscles. lactate is being transported to her liver. this is a result of aerobic respiration. strenuous exercise has caused her body to be in carbon dioxide debt, and she is breathing hard while lactate is transported to the liver. this is a result of anaerobic respiration. strenuous exercise has caused her body to be in oxygen debt, and she is breathing hard while lactate is transported to the liver. this is a result of anaerobic respiration.