PLEASE HELP!
A certain segment of DNA can be used as a molecular clock. Its rate of mutation i...
Biology, 10.02.2020 02:05 ykpwincess
PLEASE HELP!
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine the DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Be sure to answer this question in paragraph form using complete sentences.
Answers: 1
Biology, 21.06.2019 19:00
If you are in a chronic state of anxiety but also suffer from moment of sudden, intense fear you are problably suffering. from
Answers: 1
Biology, 22.06.2019 04:00
Indicate the coat color and the proportion of offspring with that color for each of the following crosses of rabbits. assume all are homozygous. agouti x albino a) 1/2 albino, 1/2 agouti b) all agouti c) 3/4 agouti, 1/4 albino
Answers: 2
Biology, 22.06.2019 12:30
Wich of the following are manual restraint techniques for dogs
Answers: 2
Biology, 22.06.2019 15:00
After frida stops exercising, she continues to breathe heavily. what is most likely occurring in her body? heavy breathing during exercise has produced an oxygen surplus in her muscles. this oxygen is being transported to her lungs. this is a result of aerobic respiration. heavy breathing during exercise has produced a carbon dioxide surplus in her muscles. lactate is being transported to her liver. this is a result of aerobic respiration. strenuous exercise has caused her body to be in carbon dioxide debt, and she is breathing hard while lactate is transported to the liver. this is a result of anaerobic respiration. strenuous exercise has caused her body to be in oxygen debt, and she is breathing hard while lactate is transported to the liver. this is a result of anaerobic respiration.
Answers: 2
Mathematics, 12.08.2019 02:10
Mathematics, 12.08.2019 02:10
History, 12.08.2019 02:10
Mathematics, 12.08.2019 02:10
History, 12.08.2019 02:10
Mathematics, 12.08.2019 02:10
Physics, 12.08.2019 02:10
Mathematics, 12.08.2019 02:10