What 5-carbon sugar makes up the dna backbone? *
a. splenda
b. cane sugar<...
Biology, 29.01.2020 01:43 kenken2583
What 5-carbon sugar makes up the dna backbone? *
a. splenda
b. cane sugar
c. deoxyribose
Answers: 1
Biology, 21.06.2019 17:30
In order to clone adult animals, scientists typically begin with a(n)
Answers: 1
Biology, 22.06.2019 10:20
The function of the excretory system is to control homeostasis and
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 18:00
The table below shows the elements that mainly comprise each of the four layers of earth: elements in layers layer main elements crust oxygen, silicon mantle iron, magnesium outer core iron, nickel inner core iron which of these elements make up the layer that is 0.2 to 1.1 percent of earth's total diameter?
Answers: 2
Mathematics, 20.11.2020 19:10
Mathematics, 20.11.2020 19:10
Mathematics, 20.11.2020 19:10
Mathematics, 20.11.2020 19:10
Mathematics, 20.11.2020 19:10
Mathematics, 20.11.2020 19:10
Mathematics, 20.11.2020 19:10
History, 20.11.2020 19:10
Mathematics, 20.11.2020 19:10
Mathematics, 20.11.2020 19:10
English, 20.11.2020 19:10