subject
Biology, 22.01.2020 18:31 psychocatgirl1

When a man has an allele combination ww for a trait, what percentage of his gametes will have a dominant allele for the trait?
a.) 75%
b.) 100%
c.) 25%
d.) 50%

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 16:00
Elements and compounds are pure substances that cannot be broken down physically into a simpler substance. a physical change doesn’t break the bonds between atoms of a substance or form new ones. compounds can be broken down by a chemical change. a chemical change breaks chemical bonds and/or forms new ones between atoms of a substance. what simple substance would a compound break into? the basic elements that make it up! for example, if you passed a very strong electric current through water you’d break the chemical bonds in water and be left with oxygen and hydrogen. which of the following is an example of a chemical change? a separating water into different glasses b breaking frozen ice cubes with a hammer c running an electric current through water d boiling water to evaporate it on a stove
Answers: 2
question
Biology, 21.06.2019 19:30
What effect does plate tectonics have an organic evolution
Answers: 1
question
Biology, 22.06.2019 07:00
Explain how you will prioritize tasks in the medical office by immediate, essential, or optional. how will you re-prioritize when disruptions occur?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
When a man has an allele combination ww for a trait, what percentage of his gametes will have a domi...
Questions