Biology, 22.01.2020 00:31 jennamae9826
The bases in the nontemplate dna strand of a particular prokaryotic gene include 10% of thymine. what percentage of the primary transcript synthesized from this gene is uracil?
Answers: 3
Biology, 22.06.2019 01:00
Nucleic acid certain protein cell membranes certain carbohydrates
Answers: 1
Biology, 22.06.2019 03:30
Apair of fruit flies reproduces and has 1,000 offspring. all 1,000 of the offspring have the alleles gg. what is the most likely combination of alleles for each parent
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 18:00
Is a fossil fem that support wegener's hypothesis of continental drift a. gondwanded b. kannemerid c. mesosaurus d. glossopters
Answers: 1
The bases in the nontemplate dna strand of a particular prokaryotic gene include 10% of thymine. wha...
History, 17.12.2020 16:50
History, 17.12.2020 16:50
Mathematics, 17.12.2020 16:50
Geography, 17.12.2020 16:50
Mathematics, 17.12.2020 16:50
Mathematics, 17.12.2020 16:50
Mathematics, 17.12.2020 16:50
Mathematics, 17.12.2020 16:50
History, 17.12.2020 16:50
Advanced Placement (AP), 17.12.2020 16:50
Mathematics, 17.12.2020 16:50