![subject](/tpl/images/cats/biologiya.png)
Biology, 12.12.2019 18:31 anthonybowie99
glucose, a monosaccharide, is found in three different polysaccharides: starch, glycogen, chitin. there are differences between the structure and function of the glucose arrangement found in these polysaccharides. which statement correctly distinguishes the difference in glucose structure in one of these polysaccharides?
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 22:30
Which statement about dna replication is true? a. eukaryotes only have one circular chromosome that unwinds at multiple locations. b. eukaryotes can only replicate one segment of a chromosome at a time. c. prokaryotes can only replicate their single circular chromosome in the nucleus. d. prokaryotes only have one origin of replication to initiate replication.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:00
Monomers are the building blocks of larger molecules, called polymers. for example, proteins are composed of chains of amino acids that are linked together. cellulose is a polymer that makes up plant cell walls. cellulose is made from a chain of c6h10o5 molecules. which monomers are most likely used to produce cellulose? why?
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 15:10
Hairs that clean dirt out of the air in your nasal passages are called: a. sinus b. trachea c. cilia d. mucus
Answers: 2
You know the right answer?
glucose, a monosaccharide, is found in three different polysaccharides: starch, glycogen, chitin. t...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 27.05.2021 01:00
![question](/tpl/images/cats/mat.png)
Mathematics, 27.05.2021 01:00
![question](/tpl/images/cats/mat.png)
Mathematics, 27.05.2021 01:00
![question](/tpl/images/cats/mat.png)
Mathematics, 27.05.2021 01:00
![question](/tpl/images/cats/mat.png)
Mathematics, 27.05.2021 01:00
![question](/tpl/images/cats/mat.png)
Mathematics, 27.05.2021 01:00
![question](/tpl/images/cats/en.png)
English, 27.05.2021 01:00
![question](/tpl/images/cats/istoriya.png)
History, 27.05.2021 01:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.05.2021 01:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.05.2021 01:00
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 27.05.2021 01:00
![question](/tpl/images/cats/mat.png)
Mathematics, 27.05.2021 01:00
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.05.2021 01:00
![question](/tpl/images/cats/biologiya.png)
Biology, 27.05.2021 01:00
![question](/tpl/images/cats/mat.png)
Mathematics, 27.05.2021 01:00