Consider a population of 5000 garter snakes. two hundred of those snakes split off from the populationto a new habitat. when the original population dropped from 5000 to 4800, the allele frequencies of variousgenes changed. the evolutionary process that caused the change in allele frequencies in the originalpopulation is: a. a. genetic drift. b.b. mutation. c.c. migration. d.d. stabilizing selection. e.e. disruptive selection.

What is a group of organisms that are closely related and share similar characteristics

The current thought on the structure of the cell membrane is: a. a static phosphate sandwich of lipids b. a fluid-mosaic of phospholipids and proteins c. a bilayer of proteins with static lipid molecules d. an impermeable bilayer of protein molecules e. a static and permeable phospholipid single layer

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?