Biology, 26.11.2019 05:31 carlosbs71
You performed a sanger sequencing reaction and obtained the following electropherogram (a computer-generated trace of the intensity of each color's fluorescence). in this figure, a = green, c = purple, g = black, t = red. the height of the peaks is unimportant. the 5' end of the sequence is at the left of the trace.
what is the sequence of the template dna used for this sequencing reaction?
a.
5' tttgctttgtgagcggataacaa 3'
b.
3' tttgctttgtgagcggataacaa 5'
c.
5' aaacgaaacactcgcctattgtt 3'
d.
5’ ttgttatccgctcacaaagcaaa 3’
e.
3' aaacgaaacactcgcctattgtt 5'
can someone with this? i can never get more than 3/5 right:
match the following terms with their descriptions below.
question selected match
used to detect close or exact complementarity to a probe sequence
c.
high stringency
used in identifying a specific mrna from a mixture
a.
northern blot
used to quantitate the initial template concentration of an unknown relative to a standard template of known concentration
b.
template dna
reliant upon dna mismatch repair
d.
site-directed mutagenesis
refers to the sequence of interest within the sample in a pcr reaction
e.
cycle threshold method (ct)
Answers: 1
Biology, 22.06.2019 16:30
Astudent sees several ants walking up a wall following the exact same trail that an ant took earlier. she wants to apply the scientific method to determine how the ants detected the trail. which of these steps would come first in her application of the scientific method? perform an experiment by cleaning the scent away from part of the trail. draw a conclusion that the ants follow a scent trail. make a prediction about what the ants will do after she cleans away part of the trail. hypothesize that the ants are following a scent trail that the first ant left.
Answers: 1
Biology, 22.06.2019 22:00
What cpt® codes are reported for the destruction of 16 premalignant lesions and 10 benign lesions using cryosurgery?
Answers: 1
Biology, 23.06.2019 00:10
Describe another example of how echnology has changed how people live
Answers: 2
Biology, 23.06.2019 00:10
1. beginning with all chambers of the heart in the "relaxed" phase, describe the cardiac cycle in mammals, with systole and diastole of the atria and ventricles. for each time point in the cycle you select, state the following: • whether the atria and ventricles are contracting or relaxing • whether the av valves and semilunar valves are closed or open • whether the pressure in the atria and ventricles is high or low
Answers: 2
You performed a sanger sequencing reaction and obtained the following electropherogram (a computer-g...
Mathematics, 28.07.2019 05:30
History, 28.07.2019 05:30
Mathematics, 28.07.2019 05:30
History, 28.07.2019 05:30
Mathematics, 28.07.2019 05:30
Mathematics, 28.07.2019 05:30
Mathematics, 28.07.2019 05:30
Mathematics, 28.07.2019 05:30
Mathematics, 28.07.2019 05:30
Mathematics, 28.07.2019 05:30