subject
Biology, 24.11.2019 21:31 linaaaa0496

Answer : )
groundwater is a significant source of freshwater for many people. do you think it’s necessary to monitor water wells for possible contamination by factories and other industries? how often should testing take place? explain your answer.

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 01:00
Acquired mutations can result from radiation pollution toxins inheritence select all that apply
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 13:40
As an asteroid comes close to earth, it's name will change to? apex
Answers: 1
question
Biology, 22.06.2019 15:50
The structure of a dna molecule is best described as a. one long strand of nucleic acids b. two strands of dna nucleotides joined by hydrogen bonds c. two strands of amino acids joined by hydrogen bonds d. one long strand of amino acids
Answers: 1
You know the right answer?
Answer : )
groundwater is a significant source of freshwater for many people. do you think it’...
Questions
question
Business, 31.08.2019 10:30