subject
Biology, 20.01.2020 01:31 IsabelAyshi

What is the name of the selectively permeable outer boundary of the cell, made of lipids and protein. it controls what goes in and out of a cell?

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 00:10
Abnormal softening of a gland is known as
Answers: 1
question
Biology, 22.06.2019 04:00
Why are fossils not found in igneous rocks? igneous rocks are made from cooling of lava or magma. igneous rocks are found too deep underground. igneous rocks are too dark in color to contain fossils. igneous rocks are too dense to contain fossils.
Answers: 2
question
Biology, 22.06.2019 06:00
In tomato plants, mendel found that the allele for smooth seeds (s) is dominant, while the allele for wrinkled seeds (s) is recessive. which of these punnett squares shows crosses between two plants heterozygous for smooth seeds? i need this to be answered as soon as ! sry the picture is bad quality
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What is the name of the selectively permeable outer boundary of the cell, made of lipids and protein...
Questions
question
Mathematics, 17.06.2021 22:50
question
Mathematics, 17.06.2021 23:00