Answers: 1
Biology, 22.06.2019 05:30
Agene pool: a) is the collection of all the alleles found in a single species b) is the collection of all the alleles found in a single population c) is the collection of all the chromosomes found in a single population d) is the collection of genes in a species that allow the individuals to swim
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 14:00
Compare the shapes of the bones of the human skull with the shapes of the bones of the human leg. how do the shapes differ? why are the shapes important?
Answers: 1
Biology, 22.06.2019 14:50
Read this summary of a scientific theory: "cells are the most basic structural and functional units of life. all living organisms are made up of one or more cells. all cells that are alive in the world today came from pre-existing cells." which of the following would require this theory to be modified? -a.) a survey finds that a majority of people believe viruses carry out the basic processes of life. -b.) a prominent scientist says she feels strongly that one day the theory will be challenged by life on other planets. -c.) the dna of unicellular and multi-cellular organisms is shown to have many fundamental similarities. -d.) scientific observations show that microscopic organisms living in the deep ocean are not made up of cells.
Answers: 1
Diference brisa marĂtima da brisa terrestre...
Mathematics, 26.06.2020 16:01
Mathematics, 26.06.2020 16:01
Mathematics, 26.06.2020 16:01
Mathematics, 26.06.2020 16:01
Chemistry, 26.06.2020 16:01