subject
Biology, 25.10.2019 20:43 bosanchez

Write a paragraph about your choice of organelle. provide the answers to these questions within your paragraph.

(also, restate. )

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 02:30
In the diagram below, the northern hemisphere would be in what season at position a a.fall b. winter c.summer d.spring
Answers: 1
question
Biology, 22.06.2019 10:40
Which of the following factors would not contribute to allopatric speciation? a) a population becomes geographically isolated from the parent population.b) the separated population is small, and genetic drift occurs.c) the isolated population is exposed to different selection pressures than the ancestral population.d) different mutations begin to distinguish the gene pools of the separated populations.e) gene flow between the two populations is extensive.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 15:30
What are potential sources of error in marta’s experiment
Answers: 1
You know the right answer?
Write a paragraph about your choice of organelle. provide the answers to these questions within your...
Questions
question
Mathematics, 09.03.2021 18:00
question
Spanish, 09.03.2021 18:00
question
English, 09.03.2021 18:00