Biology, 25.10.2019 03:43 lizzy4858

Choose true or false for the following statements.
1. steroid hormones are synthesized in the same cells where they function. truefalse
2. estrogen is a gonadocorticoid. truefalse
3. glucocorticoid receptors are membrane bound. truefalse
4. glucocorticoid receptors have a nuclear localization signal that is hidden until a glucocorticoid is bound. truefalse
5. two glucocorticoid receptors function as a homodimer. truefalse
6. glucocorticoid receptors bind to gre elements which are present on newly synthesized mrnas. truefalse

Answers: 1

Show answers

Answers

Answer from: juanitarodriguez

This is a pretty complex question with multiple parts to it. I will try to answer them and give a short explanation.

1. Steroid hormones are synthesized in the same cells where they function: False. Steroid hormones are produced in the adrenal glands, in the different portions of the gland. Each of them will go to different cells and produce their effects by directly binding to receptors on the cell´s nucleus, they do not stay to interact with the membrane of the cell.

2. Estrogen is a gonadocorticoid: True. Estrogen is primarily produced as a gonadocorticoid by the adrenal glands. They are part of the group of hormones that stimulate maturation of female body parts and maintenance of pregnancy when this happens. It also helps in the ovulation process.

3. Glucocorticoid receptors are membrane bound: False. Like all steroids, glucocorticoids, cross the plasma membrane and act directly on DNA by binding to receptors that cross into the nucleus itself.

4. Glucocorticoid receptors have a nuclear localization signal that is hidden until a glucocorticoid is bound: True. These receptors, known as GR´s (Glucocorticoid receptors) tend to be present in the cytoplasm and activate once a glucocorticoid crosses the membrane. These receptors will increase in number and carry the hormone towards the nucleus, where they will affect the DNA directly.

5. Two glucocorticoid receptors function as a homodimer: True. This is found the research done on how GR´s work to produce their effect. There has been research that shows they can work as heterodimers, but essentially, they work as homodimers.

6. Glucocorticoid receptors bind to GRE elements which are present on newly synthesized mRNAs. False. Essentially, and most simply, because glucocorticoids affect DNA, and the receptors will bind with DNA, not RNA.

Answer from: Quest

i would go with b

cytokinesis occurs after telophase so that eliminates d

and the entire reason for cytokinesis is for cellular reproduction

Answer from: Quest

Hunting in the darksome fish rely on senses beyond sight. in the darkness of the marianas trench, a fish called the rattail has an extremely sensitive sense of smell. the fish uses scent, rather than sight, to steer toward food. once it's near food, the rattail uses a special organ on the bottom of its chin to guide itself by feel.marine snowone staple of the deep sea diet is "marine snow," flakes of organic, edible substances that sink down from the upper ocean. animals at the ocean's bottom find sustenance in everything from the bodies of dead creatures to fecal matter. marine snow is diverse enough to support numerous species. for instance, several species of snails and worms feed exclusively on deceased whales.microorganismsthe deep sea is an intricate ecosystem, and even the ocean floor itself plays a part. hydrothermal vents are cracks in the sea floor where erupting magma mixes with ocean water to produce plumes of hot, sulfur-rich chemicals. some microbes can use these chemicals for energy, sustaining their existence and that of the animals who depend on their roles in the deep sea food chain.

Another question on Biology

Biology, 22.06.2019 03:50

The breakdown of food is accomplished by enzymes. a. physical b. chemical c. mechanical d. none of the above

Answers: 1

Answer

Biology, 22.06.2019 05:00

Jason adds the antibiotic penicillin to a bacterial culture. the bacteria develop genetic modifications in their genome, which gives them resistance to the antibiotic penicillin. what caused this genetic modification?

Answers: 2

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

Biology, 22.06.2019 15:30

The most effective way to provide children with safety messages is to

Answers: 3

Answer

You know the right answer?

Choose true or false for the following statements.
1. steroid hormones are synthesized in the...

Questions