Choose true or false for the following statements.
1. steroid hormones are synthesized in the same cells where they function. truefalse
2. estrogen is a gonadocorticoid. truefalse
3. glucocorticoid receptors are membrane bound. truefalse
4. glucocorticoid receptors have a nuclear localization signal that is hidden until a glucocorticoid is bound. truefalse
5. two glucocorticoid receptors function as a homodimer. truefalse
6. glucocorticoid receptors bind to gre elements which are present on newly synthesized mrnas. truefalse
Answers: 1
Biology, 22.06.2019 03:50
The breakdown of food is accomplished by enzymes. a. physical b. chemical c. mechanical d. none of the above
Answers: 1
Biology, 22.06.2019 05:00
Jason adds the antibiotic penicillin to a bacterial culture. the bacteria develop genetic modifications in their genome, which gives them resistance to the antibiotic penicillin. what caused this genetic modification?
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:30
The most effective way to provide children with safety messages is to
Answers: 3
Choose true or false for the following statements.
1. steroid hormones are synthesized in the...
1. steroid hormones are synthesized in the...
Social Studies, 23.03.2021 06:00
Mathematics, 23.03.2021 06:00
Mathematics, 23.03.2021 06:00
Mathematics, 23.03.2021 06:00
Mathematics, 23.03.2021 06:10
English, 23.03.2021 06:10
Social Studies, 23.03.2021 06:10
Arts, 23.03.2021 06:10
Mathematics, 23.03.2021 06:10
Mathematics, 23.03.2021 06:10
Mathematics, 23.03.2021 06:10
Mathematics, 23.03.2021 06:10