As dna replication continues and the replication bubble expands, the parental double helix is unwound and separated into its two component strands. this unwinding and separating of the dna requires three different types of proteins: helicase, topoisomerase, and single-strand binding proteins. sort the phrases into the appropriate bins depending on which protein they describe.

What is the name for a substance formed in a chemical reaction

What do isotopes of uranium have the same number of? what do they have a different number of? a) same number of protons; different number of electrons b) same number of protons; different number of neutrons c) same number of electrons; different number of protons d) same number of neutrons; different number of protons

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?