Biology, 27.09.2019 00:20 Schaughn

Which of the following is not an example of an epigenetic phenomenon provided by dr. carey on evidence that genetic identity does not lead to identical phenotypes in organisms?

a) kittens turn into cats
b) maggots turn into flies
c) some reptiles' genders are determined by the temperature of their nests
d) humans have 200 different types of cells that develop from 1 dna code

Answers: 1

Show answers

Answers

Answer from: asvpla

c) Some reptile' s genders are determined by the temperature of their nests.

Explanation:

DNA has the instructions for various functional proteins to be produced inside the cell, so it determines the genotype of an organism. The sequence of DNA indicates which proteins will be produced. If there is a change in this sequence, another protein may be produced.

Epigenetics is the study of changes in gene expression that are not caused by changes to the DNA sequence. This means, there is a change in the phenotype (organism's observable characteristics or traits) without a change in genotype. Thereby, epigenetics affects how genes are read by cells, and whether they cells should produce proteins or not, or which specific proteins.

Epigenetic changes can be influenced by many different factors such as age, lifestyle, environment, among others. And ther are three systems known that produce epigenetic changes:

DNA methylationHistone modificationNon-coding RNA (ncRNA)

They are associated with gene silencing are considered to initiate and sustain epigenetic change.

In the question, kittens turning into cats is a normal process determined by the DNA, so as maggots turning into flies. Humans having 200 different types of cells that develop from one DNA code is talking about how DNA has the instructions of every process of the body. And according to what genes are transcribed into RNA, those genes will code for specific proteins inside each type of cell, based on the needs of the cellular functions.

But, some reptile's gengers are determined by temperature, it an example of epigenetic. Gender after fertilization because the temperature of the developing eggs is what decides whether the offspring will be male or female. Temperature affects gene activity and expression without changing the DNA sequenced that was established at the time of fertilization.

Answer from: Quest

The answer is 0.01 meter

Answer from: Quest

Prompt: write about whether or not you plan to register to vote when you are 18 and what political party preference (if any) you will disclose. explain the reasons for your decisions.

Another question on Biology

Biology, 22.06.2019 04:00

Select the correct answer. which mutation is harmful to the organism? a. a mutation allowing moths to camouflage better on blackened tree bark b. a mutation making staphylococcus aureus resistant to the antibiotic methicillin c. a mutation inhibiting human immunodeficiency virus from attaching to and entering the cell d. a mutation causing uncontrolled cell division e. a mutation giving plant leaves a bitter taste to discourage herbivores from eating them

Answers: 1

Answer

Biology, 22.06.2019 05:30

Diego conducted an experiment to find out what kind of ball bounces the highest when dropped from a five-foot platform. he used a golf ball, a tennis ball, and a soccer ball. he dropped each ball from the balcony once. diego recorded his observations after each drop. what can diego do to best improve the reliability of his results? a) drop each ball from the platform three more times b) record his observations in more than one unit c) write at least two scientific questions after the experiment is complete d) share his results with other people who have done similar experiments you for the !

Answers: 1

Answer

Biology, 22.06.2019 06:00

If jane has the blood type ab and marries john who has type o blood what are the possible phenotypes of their first kid?

Answers: 3

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

Which of the following is not an example of an epigenetic phenomenon provided by dr. carey on eviden...

Questions