Biology, 17.09.2019 17:30 yolinda123429
John and pat are identical twins with identical dna. john works in a movie theater, and pat works as a lifeguard. they have very different skin pigmentation. which is the best explanation of the difference?
skin color, a polygenic trait, is also determined by environmental factors.
skin color, a polygenic trait, is also determined by the sex of the individual.
skin color, a trait that demonstrates incomplete dominance, is also determined by environmental factors.
skin color, a trait that demonstrates incomplete dominance, is also determined by the sex of the individual.
Answers: 3
Biology, 21.06.2019 21:30
Select the best answer for the question, ly 12. which of the following behaviors is not an inherited behavior?
Answers: 2
Biology, 22.06.2019 05:50
Which of the organisms listed below performs nitrogen fixation? a. legumes b. plants c. bacteria d. fungi
Answers: 2
Biology, 22.06.2019 06:10
The normal shape of an enzyme is as shown in structure a. if the enzyme’s shape changes to that shown in structure b, what are two consequences of this change?
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
John and pat are identical twins with identical dna. john works in a movie theater, and pat works as...
History, 28.07.2020 04:01
Social Studies, 28.07.2020 04:01
Social Studies, 28.07.2020 04:01
Mathematics, 28.07.2020 04:01
Mathematics, 28.07.2020 04:01
Mathematics, 28.07.2020 04:01
Biology, 28.07.2020 04:01
Mathematics, 28.07.2020 04:01
Biology, 28.07.2020 04:01
Social Studies, 28.07.2020 04:01
Mathematics, 28.07.2020 04:01
Mathematics, 28.07.2020 04:01
Mathematics, 28.07.2020 04:01