![subject](/tpl/images/cats/biologiya.png)
Biology, 27.09.2019 14:00 southsan2021
What two scientists established the structure of dna?
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 18:30
Fungi exist as single cells or as branching networks of multicellular filaments. how does the structure of filaments relate to their function
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 23.06.2019 01:40
30 points why do tornadoes happen more frequently in the summer? they require warm air. they form over large, warm bodies of water. they require dry air. they require dust which is present in the summer.
Answers: 1
You know the right answer?
What two scientists established the structure of dna?...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 14.04.2021 01:00
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.04.2021 01:00
![question](/tpl/images/cats/himiya.png)
Chemistry, 14.04.2021 01:00
![question](/tpl/images/cats/ekonomika.png)
Business, 14.04.2021 01:00
![question](/tpl/images/cats/mat.png)
Mathematics, 14.04.2021 01:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/User.png)
Engineering, 14.04.2021 01:00
![question](/tpl/images/cats/biologiya.png)
Biology, 14.04.2021 01:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/geografiya.png)
Geography, 14.04.2021 01:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.04.2021 01:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/health.png)
Health, 14.04.2021 01:00
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.04.2021 01:10