![subject](/tpl/images/cats/biologiya.png)
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:00
Which of the following statements about archaea and bacteria is true? a. neither is single-celled. b. they both have nuclear membranes. c. neither reproduces by binary fission. d. they both lack a nuclear membrane.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:20
There are only about 250,000 known fossil species. true or false
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 17:10
How would you describe an allele that be expressed and determines an organisms appearance? a.uncapitalized b.responsive c.recessive d.dominant
Answers: 1
You know the right answer?
The branch of biology concerned with identifying, naming, and classifying all living things is taxon...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 10.09.2019 23:30
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/es.png)
Spanish, 10.09.2019 23:30
![question](/tpl/images/cats/mat.png)
Mathematics, 10.09.2019 23:30
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/istoriya.png)