Biology, 09.09.2019 02:10 harveyangel123p2tjae
Explain what is meant by the big bang, and how to calculate the time when it happened
Answers: 1
Biology, 22.06.2019 07:20
Agroup of plant cells was exposed to radiation, which damaged the chloroplasts and caused them to lose function. if the mitochondria were unharmed, what would happen to the overall function of the plant cells? a. the cells would not be able to make food, but would be able to release energy from biomolecules. b. the cells would not be able to replicate dna, but would be able to break down waste. c. the cells would not be able to break down waste, but would be able to replicate dna. d. the cells would not be able to release energy from biomolecules, but would be able to make food.
Answers: 1
Biology, 22.06.2019 11:30
Which of the following statements is true about the relationship between genetic variation and natural selection? a. genetic variation must be present in a population before natural selection can act on it. b. genetic variation arises in a population as a result of natural selection. c. natural selection can act on a population whether there is genetic variation within the population or not. d. after natural selection acts on a population, the amount of genetic variation in the population always increases.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 14:50
An organism's reproductive strategy includes all of the following except a. the number of offspring produced. b. the amount of energy expended in producing offspring. c. the length of time parental care is given d. the number of alleles an organism passes on.
Answers: 3
Explain what is meant by the big bang, and how to calculate the time when it happened...
Mathematics, 25.11.2021 14:00
History, 25.11.2021 14:00
Biology, 25.11.2021 14:00
Arts, 25.11.2021 14:00
Social Studies, 25.11.2021 14:00
Mathematics, 25.11.2021 14:00
Mathematics, 25.11.2021 14:00
Computers and Technology, 25.11.2021 14:00