subject
Biology, 30.08.2019 06:20 christhegreat1

True or false?
the air circulates counterclockwise in b because the water cools slower than the land.


True or false?  the air circulates counterclockwise in b because the water cools slower than t

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:20
Which of the following is most likely the result of an organism having lipids in its body a) water cannot be absorbed through the surface of a leaf b)human eats fruits to get a quick source of energy c) a sheep sleeps for more hours in the winter d) a warm river is filled with fish and algae
Answers: 1
question
Biology, 22.06.2019 15:20
Use the numbers to place the companies in order of greatest comparative advantage to least comparative advantage in producing large tubes of toothpaste.
Answers: 3
question
Biology, 22.06.2019 16:30
This is the nitrogenous base only found in rna
Answers: 1
You know the right answer?
True or false?
the air circulates counterclockwise in b because the water cools slower than t...
Questions
question
Geography, 01.11.2019 19:31
question
History, 01.11.2019 19:31