![subject](/tpl/images/cats/biologiya.png)
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 14:00
A3-year-old child with nephrotic syndrome has been receiving prednisone for 1 week. the nurse reviews the child's progress record and determines that the medication has been effective. what information supports this conclusion? select all that apply.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:30
Kudzu vines grow by climbing and wrapping around trees. trees covered by kudzu can die because they are starved of sunlight. what type of relationship exists between the trees and the kudzu growing on them?
Answers: 2
![question](/tpl/images/cats/biologiya.png)
You know the right answer?
In recombinant dna technology, a vector is a self-replicating segment of dna, such as a plasmid or v...
Questions
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 04.04.2020 09:30
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 04.04.2020 09:30
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 04.04.2020 09:31
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 04.04.2020 09:31
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 04.04.2020 09:31
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 04.04.2020 09:32
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
English, 04.04.2020 09:32
![question](/tpl/images/cats/en.png)
English, 04.04.2020 09:32
![question](/tpl/images/cats/mat.png)