(will mark brainliest, i need urgently) what is the dna sequence, resulting mrna sequence, complementary trna sequence, and resulting amino acid sequence

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

bc blah

explanation:

bc blah

some of your causes might be acidic rain or natural wildfires that cause the parks to be degraded

hope this any more questions i am here plz mark brainliest