![subject](/tpl/images/cats/biologiya.png)
Biology, 28.01.2020 14:04 Nolanrdavis
In sickle-cell disease, variation in one gene causes red blood cells to bend, or sickle. this means the sickled cells
a)are better at destroying the malaria parasite
b)carry toxic levels of oxygen through the body
c)cannot carry normal levels of oxygen to cells
d)attract larger numbers of the malaria parasite
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 16:00
Which of the following would involve looking at different structures of organisms and comparing how similar they are? a. vestigial structuresb. radiometric datingc. homologous structures
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 22:30
Afive-year study was carried out on a population of algae in a lake. the study found that the algae population was steadily decreasing in size. over the five-year period this decrease most likely led to
Answers: 3
You know the right answer?
In sickle-cell disease, variation in one gene causes red blood cells to bend, or sickle. this means...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/mkx.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 15.10.2019 18:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 15.10.2019 18:00
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 15.10.2019 18:00
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)