Consider the following sequence of genomic dna which is a template strand containing the beginning of the open reading frame for a gene. 3'taaactgtacagggccataact..5' a) find the open reading frame and identify the start codon by circling it. b) transcribe the open reading frame into a strand of mrna. identify the start codon by circling it. c) what is the peptide encoded by this strand of mrna.

According to the base pairing rules, in RNA adenine pairs with uracil (A-U) in RNA, and cytosine pairs with guanine (C-G).

a) It is known that the most common codon is AUG. The start codon is the first codon of mRNA, that's why it contains U. So, a complementary DNA code must be TAC, so it will be transcribed into AUG:
3'TAAACTGTACAGGGCCATAACT5'

b) Starting from the start codon AUG and according to the base pairing rules, mRNA will be transcribed into the following sequence:

DNA:       3'TAAACTGTACAGGGCCATAACT5'
RNA:                          AUGUCCCGGUAUUGA

c) According to the genetic code chart, the following mRNA sequences will code for the following amino acid sequences:

RNA:       AUG UCC CGG UAU UGA
Protein:    Met-Ser-Arg-Tyr-

The last codon (UGA) is a stop codon, so it will not be translated. It is a signal for translation termination. 

The answer is observations and interpreting.