Could someone explain why this is wrong? which of the following concerning allosteric inhibitors is not true? a) can inhibit an enzyme by changing the shape of the active site b) can inhibit an enzyme by changing the shape of the enzyme c) can inhibit an enzyme by covering the active site d) all of these are not true the answer was d, but i don't understand why. i put b because it only changes the shape of the active site and not the enzyme itself, but that was wrong.
Answers: 2
Biology, 22.06.2019 02:30
Apaleontologist finds a plant fossil that shows that the plant had seeds. what can the paleontologist conclude?
Answers: 1
Biology, 22.06.2019 10:30
Apopulation of rabbits live in a local forest. some had a mutation for a large body and long legs. the graph below shows the number of both the mutant and the normal rabbits over 5 generations. which of the following statements is true for this scenario? question 7 options: the rabbits with the mutation were more successful with restricted food than the normal rabbits. both sets of rabbits were equally successful with the restricted food source.i the normal rabbits were more successful with restricted food than the rabbits with the mutation. the graph does not let us know which rabbit was more successful.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:10
The importance of the mind as a part of the body is an example of:
Answers: 1
Could someone explain why this is wrong? which of the following concerning allosteric inhibitors is...
Mathematics, 29.07.2019 22:00
Biology, 29.07.2019 22:00
English, 29.07.2019 22:00