subject
Biology, 26.06.2019 19:00 joannegrace869

If the heterotrophs in level 2 of a trophic pyramid produce 20,000 kilograms of biomass, how much energy did the autotrophs produce? a 20 kg b 200 kg c 2,000 kg d 200,000 kg

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 21:30
92 sathe best for the question 11. most animals and plants reproduce sexually. this means that dna is passed down to new organisms from two parental organisms. which of the following is a key advantage of sexual reproduction?
Answers: 3
question
Biology, 22.06.2019 01:10
Determine if the following statement is true or false. if true, choose true. if false, choose the rewording that is true. according to the law of independent assortment, alleles for each gene are inherited together so that they always stay together. according to the law of independent assortment, offspring express a combination of their parents' traits. according to the law of independent assortment, alleles for a characteristic split during meiosis and combine during fertilization. true according to the law of independent assortment, alleles for each gene are inherited independently so that no two alleles stay together.
Answers: 1
question
Biology, 22.06.2019 02:00
Despite the differences in mature plant cells, all of them are derived from meristem cells. the three major types of tissue systems develop from the meristem. meristems develop cells in all but which tissue?
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
If the heterotrophs in level 2 of a trophic pyramid produce 20,000 kilograms of biomass, how much en...
Questions
question
Mathematics, 01.03.2021 17:20
question
Mathematics, 01.03.2021 17:20
question
Mathematics, 01.03.2021 17:20
question
SAT, 01.03.2021 17:20