Ican't seem to understand this. fill in the blanks to complete each statement about how mountains affect precipitation. coastal mountains force cool, moist air from oceans to rise as it moves toward land. clouds form, and precipitation falls on the side of the mountain. on the side of the mountain, very little precipitation falls.
Answers: 2
Biology, 22.06.2019 02:00
The phylogenetic tree illustrates the relationship between humans and our closest living relatives. the tree was based on biochemical comparisons, including dna and amino acid sequences. according to the biomolecular data, we could infer that a) the four organisms do not have a common ancestor. b) humans are more closely related to chimps than any other apes. c) chimps are more closely related to gorillas than they are to humans. eliminate d) there is no evidence if any relationship between the four branches on the tree.
Answers: 3
Biology, 22.06.2019 03:30
Identify any four organelles that should be present in the eukaryotic organism and describe the function of each organelle
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:30
Explain how light energy is turned into chemical energy? ! due tomorrow!
Answers: 1
Ican't seem to understand this. fill in the blanks to complete each statement about how mountains af...
English, 30.11.2021 14:00
Social Studies, 30.11.2021 14:00
SAT, 30.11.2021 14:00
English, 30.11.2021 14:00
Computers and Technology, 30.11.2021 14:00
History, 30.11.2021 14:00
Biology, 30.11.2021 14:00
Mathematics, 30.11.2021 14:00
Computers and Technology, 30.11.2021 14:00
Mathematics, 30.11.2021 14:00
Computers and Technology, 30.11.2021 14:00