subject
Biology, 28.06.2019 00:30 kellyroy74

Which statement best distinguishes plant and animal as they relate to amino acids? a) plans can synthesize all twelve amino acids. humans must eat plans or animals to obtain some of these amino acids b) plans can synthesize all twelve amino acids. humans must eat plans to obtain all of these amino acids c) plans can only synthesize ten amino acids. humans synthesize the other ten amino acids d) plans and humans both synthesize all twelve amino acids. humans must supplement a few of these by eating plans.

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 04:30
What is the similarities and differences between bacteria and eukaryote?
Answers: 3
question
Biology, 22.06.2019 10:30
16. which of the following accurately describes a step within transcription? a. dna polymerase uses one strand of rna as a template to put together nucleotides. b. the dna strand is used as a template for which a complementary rna strand can be produced. c. the rna strand forms a template by which dna can be built. d. the rna strand is produced within the cytoplasm.
Answers: 3
question
Biology, 22.06.2019 11:20
Drag each label to the correct location on the chart. match the function to the type of tissue
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Which statement best distinguishes plant and animal as they relate to amino acids? a) plans can syn...
Questions
question
World Languages, 27.10.2019 18:43
question
History, 27.10.2019 18:43
question
Physics, 27.10.2019 18:43