What is the dna compliment to the given strand tacgtatgccgtatgggcatt

On a backpacking trip, kenny hikes all day at a steady pace, covering 30 kilometers and burning 4000 calories. at the school track, janelle runs the 100-meter sprint in 13.5 seconds, burning 10 calories. afterward, janelle’s leg muscles are aching and she is breathing hard, while kenny maintains normal breathing all day, even though he burns 400 times more calories than janelle. which two statements offer the best explanation for this phenomenon? a. if the aerobic pathway—cellular respiration—cannot meet the energy demand, then the anaerobic pathway—lactic acid fermentation—starts up, resulting in lactic acid buildup and "oxygen debt." b. aerobic cellular respiration produces more energy, but its use is limited because of lactic acid buildup in the muscles and the resulting "oxygen debt." c. after about 90 seconds of intense exercise, the muscles become depleted of oxygen, and anaerobic respiration can no longer function to produce atp, resulting in "oxygen debt." d. the rate of energy demand determines how the muscles will obtain energy, either from cellular respiration or from lactic acid fermentation if not enough oxygen is present.