All living things are made of one or more cells, and those cells are either eukaryotic or prokaryotic. you, like all animals as well as plants and fungi, have eukaryotic cells. that means your cells have a nucleus. inside that nucleus, genetic material (dna) is coiled into thread-like chromosomes. organisms with eukaryotic cells are called eukaryotes. prokaryotic cells, on the other hand, are more simple. they lack specialized, membrane-bound organelles, like mitochondria, and they do not have a nucleus. their genetic material is usually in a loop that floats in the cytoplasm. that loop is called the nucleoid. prokaryotic cells are much smaller than eukaryotic cells. all bacteria are unicellular, made of just one cell, and they are prokaryotes. some bacteria have flagella, tail-like structures on the end that them to move. how are bacteria cells different from human cells?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?