Answers: 2
Biology, 22.06.2019 02:00
Which statements describe resources? one of the factors people use when deciding where they will live is the availability of resources. renewable resources have little value for people. resources are unevenly distributed throughout the world. energy is the world resource which has the highest use. the use of nonrenewable resources has decreased in recent history. the use of resources is evenly distributed throughout the world. the world's oil supply will last for the next forty years if its use continues as expected.
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 14:00
Which diagram best represents the chromosomes that would be found in a two new skin cells produced as a result of this process?
Answers: 1
Mutation is one cause of variation. state one other cause of variation....
History, 06.10.2019 10:01
Arts, 06.10.2019 10:01
Chemistry, 06.10.2019 10:01
Physics, 06.10.2019 10:01
English, 06.10.2019 10:01
History, 06.10.2019 10:01
History, 06.10.2019 10:01
Mathematics, 06.10.2019 10:01