Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:30
The big bang theory suggest that the universe is about - 300 million years old - 4.6 billion years old - 30 billion years old - 13 billion years old
Answers: 2
Biology, 22.06.2019 16:00
Been sitting here trying to take this test and don't know this answer! place the events of a feedback mechanism associated with body temperature in the correct order. ·nerve cells send message from skin to the brain ·body returned to normal temperature around 98.6 degrees f ·temperatures regulation center in the brain sends out signals ·body temperature exceeds 98.6 degrees f ·sweat glands throughout the body activate to cool off skin surface it is a 1 through 5 question in biology!
Answers: 2
Biology, 22.06.2019 16:30
Urgent in guinea pigs, black fur (b) is dominant over white fur (b). cross a heterozygous (hybrid) black guinea pig with a homozygous (purebred) white guinea pig. complete a punnett square, identify the genotype(s), phenotype(s), and probability (% and fraction) that the offspring will be black and white?
Answers: 1
Atgaaagcctatgcacca what does this sequence provide coding for?...
Mathematics, 19.10.2019 05:30
Mathematics, 19.10.2019 05:30
Mathematics, 19.10.2019 05:30
Mathematics, 19.10.2019 05:30
Mathematics, 19.10.2019 05:30
Mathematics, 19.10.2019 05:30